How to resolve the algorithm Bioinformatics/base count step by step in the APL programming language

Published on 12 May 2024 09:40 PM
#Apl

How to resolve the algorithm Bioinformatics/base count step by step in the APL programming language

Table of Contents

Problem Statement

Given this string representing ordered DNA bases:

Let's start with the solution:

Step by Step solution about How to resolve the algorithm Bioinformatics/base count step by step in the APL programming language

Source code in the apl programming language

      bases←'CGTAAAAAATTACAACGTCCTTTGGCTATCTCTTAAACTCCTGCTAAATGCTCGTGCTTTCCAATTATGTAAGCGTTCC',
      'GAGACGGGGTGGTCGATTCTGAGGACAAAGGTCAAGATGGAGCGCATCGAACGCAATAAGGATCATTTGATGG',
      'GACGTTTCGTCGACAAAGTCTTGTTTCGAGAGTAACGGCTACCGTCTTCGATTCTGCTTATAACACTATGTTC',
      'TTATGAAATGGATGTTCTGAGTTGGTCAGTCCCAATGTGCGGGGTTTCTTTTAGTACGTCGGGAGTGGTATTA',
      'TATTTAATTTTTCTATATAGCGATCTGTATTTAAGCAATTCATTTAGGTTATCGCCGCGATGCTCGGTTCGGA',
      'CCGCCAAGCATCTGGCTCCACTGCTAGTGTCCTAAATTTGAATGGCAAACACAAATAAGATTTAGCAATTCGT',
      'GTAGACGACCGGGGACTTGCATGATGGGAGCAGCTTTGTTAAACTACGAACGTAAT'
      50 {w←⍺⋄s←⍵⋄{(w×1-⍨⍵),((w÷⍨≢s) w ⍴s)[⍵;]} ⍳(≢s)÷⍺} bases
      {⍵,':',+/bases=⍵}¨∪bases[⍋∪bases]
      'Total:',≢bases

You may also check:How to resolve the algorithm Factors of a Mersenne number step by step in the CoffeeScript programming language
You may also check:How to resolve the algorithm ABC problem step by step in the ABAP programming language
You may also check:How to resolve the algorithm Display a linear combination step by step in the Java programming language
You may also check:How to resolve the algorithm RIPEMD-160 step by step in the M2000 Interpreter programming language
You may also check:How to resolve the algorithm Parametric polymorphism step by step in the C++ programming language